View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16175_low_4 (Length: 325)
Name: NF16175_low_4
Description: NF16175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16175_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 64 - 307
Target Start/End: Complemental strand, 54504851 - 54504608
Alignment:
| Q |
64 |
acgtctccgaggatgaggaattggagttgatgaccaaggcgtgggtggtgaaggtggcggaggaggggaagaaagtatgggagctgccataacaacaaca |
163 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
54504851 |
acgtctcggaggatgaggaattggagttgatgaccgaggcgtgggtggtgaaggcggcggaggaggggaagaaagtacgggagctaccataacaacaaca |
54504752 |
T |
|
| Q |
164 |
gctagctttaaacccaacctgcaatgacgcttttttccacttatgaaatgatgtattcctgttttcttaagcaccaccattgtattgccgtcgtagtggt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54504751 |
gctagctttaaacccaacctgcaatgacgcttttttccacttatgaaatgatgtattcctgttttcttaagcaccaccattgtattgccgtcgtagtggt |
54504652 |
T |
|
| Q |
264 |
ctacatgctctcctcttattctacatctatcatagtcttcctct |
307 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54504651 |
ctacatgctctcctcttattccacatctatcatagtcttcctct |
54504608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 155 - 276
Target Start/End: Complemental strand, 54496660 - 54496539
Alignment:
| Q |
155 |
acaacaacagctagctttaaacccaacctgcaatgacgcttttttccacttatgaaatgatgtattcctgttttcttaagcaccaccattgtattgccgt |
254 |
Q |
| |
|
||||| ||||| |||||||| |||| | |||||||||||||| |||||||||||||||||| || |||| |||| | |||||| ||| | || ||||||| |
|
|
| T |
54496660 |
acaacgacagccagctttaatcccatcttgcaatgacgctttgttccacttatgaaatgatatactcctattttatcaagcacaaccttagtgttgccgt |
54496561 |
T |
|
| Q |
255 |
cgtagtggtctacatgctctcc |
276 |
Q |
| |
|
||| ||| || ||||| ||||| |
|
|
| T |
54496560 |
cgtggtgctccacatgttctcc |
54496539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University