View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16176_high_15 (Length: 307)
Name: NF16176_high_15
Description: NF16176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16176_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 6 - 292
Target Start/End: Original strand, 33161224 - 33161510
Alignment:
| Q |
6 |
agaagcataggacaaaacttgaacactcactttgacatggaaggacctaacagaggattttcagcgagaggctgaaacgagaaccttccaagagatggaa |
105 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161224 |
agaatcatagaacaaaacttgaacactcactttgacatggaaggacctaacagaggattttcagcgagaggctgaaacgagaaccttccaagagatggaa |
33161323 |
T |
 |
| Q |
106 |
aagtgcaatcaccgtgagaattggtgaagcaatcgttgacgagcatcgtggcaatgaagaaccctagttggattaacaccataacagaaattacccatgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161324 |
aagtgcaatcaccgtgagaattggtgaagcaatcgttgacgagcatcgtggcaatgaagaaccctagttggattaacaccataacagaaattacccatgt |
33161423 |
T |
 |
| Q |
206 |
gtcacctctgcggcggagacggcggcaggatttgagctgcggatcttgaggaagatcgagtgggagcttcttcgccggagaagaaag |
292 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161424 |
gtcacctctgcggcggagacgacggcaggatttgagctgcggatcttgaggaagatcgagtgggagcttcttcgccggagaagaaag |
33161510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University