View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16176_low_21 (Length: 223)
Name: NF16176_low_21
Description: NF16176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16176_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 24 - 203
Target Start/End: Complemental strand, 39373549 - 39373370
Alignment:
| Q |
24 |
gaaacggattcttggattgttatcattagaagattgatctcgcattttaacctctcttcgaatttgtccacggcctccttcagtttttagcttggaacac |
123 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
39373549 |
gaaacggattcttggattgttgtcattagaagattgatctcgcattttaacctctcttcgaatttgttcacggcctccttcaatttttagtttggaacac |
39373450 |
T |
|
| Q |
124 |
cttagtttcgcaatattgttttttataacttccttaaccggtttcttcgagacactggttagtataactcttcttttgat |
203 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| | |||| | |||||||||||||||||||||||||||||| |
|
|
| T |
39373449 |
cttagtttcgcaatattattttttataacttccttaaccgatgtctttgggacactggttagtataactcttcttttgat |
39373370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University