View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16176_low_23 (Length: 215)
Name: NF16176_low_23
Description: NF16176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16176_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 21435936 - 21435876
Alignment:
| Q |
151 |
tcatagattataccattggcaaatgaaattatagattgcataatgcaattagcaggttctg |
211 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21435936 |
tcatatattataccattggcaaatgaaattatagattgcataatgcaattagcaggttctg |
21435876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 45 - 114
Target Start/End: Complemental strand, 27155511 - 27155442
Alignment:
| Q |
45 |
taaatataaaataactttcatctaatttgatcttgcgttttttcttttatcttttatataagcgacatat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | | |||||||||||||||||| ||||||| |
|
|
| T |
27155511 |
taaatataaaataactttcatctaatttgatcttatgtgtctgattttatcttttatataagtgacatat |
27155442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University