View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_high_120 (Length: 202)
Name: NF16177_high_120
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_high_120 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 4674942 - 4674775
Alignment:
| Q |
19 |
aagaaggttagtggaaaaatacaagaatgaagaaataagcataactataacaggtcacagtttaggtgctgcaattgcaactctaaatgcagtggacatt |
118 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4674942 |
aagaaggttggtggagaaatacaagaatgaagaaataagcataactataacaggtcacagtttaggtgctgcaattgcaactctaaatgcagtggacatt |
4674843 |
T |
|
| Q |
119 |
gttacaaatggttttaacaagccaagtgatccatctcttaaagcatcaccagttacagccatagtatt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4674842 |
gttacaaatggttttaacaagccaagtgatccatctcttaaagcatcaccagttacagccatagtatt |
4674775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 37 - 114
Target Start/End: Complemental strand, 34548310 - 34548233
Alignment:
| Q |
37 |
atacaagaatgaagaaataagcataactataacaggtcacagtttaggtgctgcaattgcaactctaaatgcagtgga |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||| || |||||||| |||| |||| |||||||| ||| | ||||||| |
|
|
| T |
34548310 |
atacaagaatgaagaaattagcataactgtaactggacacagtttgggtggtgcacttgcaactataagttcagtgga |
34548233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University