View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_high_65 (Length: 326)
Name: NF16177_high_65
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_high_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 115 - 308
Target Start/End: Original strand, 14707794 - 14707990
Alignment:
| Q |
115 |
tataaatttcatcaacatagaagtaacgaaacaaca---acaacatcattgatgatttactagtttctaggattttctatgaatagagagtaggaaggat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14707794 |
tataaatttcatcaacatagaagtaacgaaacaacataaacaacatcattgatgatttactagtttctaggattttctatgaatagagagtagcaaggat |
14707893 |
T |
|
| Q |
212 |
tcttgagatttattggaaactctagcgcaaaacattagtctcacatgatacataaaggggattttaatgacatgaatcgaatagagataaacgaaat |
308 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
14707894 |
tcttggaatttattgcaaactctagcgcaaaacattagtctcacatggtacataaaggggattttaattacatcaatcgaatagagataaacgaaat |
14707990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 14707433 - 14707536
Alignment:
| Q |
15 |
ttggttttggtggagcc-tttg-agttgatcctgttggcagaagcggtggacttgattgcatgtggaggcaaccttttcaatgtaaacttgataaattat |
112 |
Q |
| |
|
||||||||||||||||| |||| |||||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14707433 |
ttggttttggtggagccatttgcagttgatcgtgttggtagaagcggtggacttgattgcctgtggaggcaaccttttcaatgtaaacttgataaattat |
14707532 |
T |
|
| Q |
113 |
gcta |
116 |
Q |
| |
|
|||| |
|
|
| T |
14707533 |
gcta |
14707536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University