View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_high_67 (Length: 323)
Name: NF16177_high_67
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_high_67 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 71 - 310
Target Start/End: Complemental strand, 4144107 - 4143868
Alignment:
| Q |
71 |
tcgagagttaaaggaaaggaaagcttaacatacctataaataggtatgttttttgcgggcgggcttgggctcaaagcccatgagcttttttccccttctt |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4144107 |
tcgagagttaaaggaaaggaaaacttaacatacctataaataggtatgttttttgcgggtgggcttgggctcaaagcccatgagcttttttccccttctt |
4144008 |
T |
|
| Q |
171 |
atacaggtgcgttagaagtaaattagaggggtgcaaataacaatcctcatcttttcctcttatattaagatgggcccattattatcgggcccaatacagt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4144007 |
atacaggtgcgttagaagtaaattagaggggtgcaaataacaatcctcatcttttcctcttatattaagatgggcccattattatcgggcccaatacagt |
4143908 |
T |
|
| Q |
271 |
gtgtaatgaactacgttgacggtgccatgctcttcccttc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4143907 |
gtgtaatgaactacgttgacggtgccatgctcttcccttc |
4143868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 4144180 - 4144151
Alignment:
| Q |
1 |
caattcgcatacaacaactagaagaagaag |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4144180 |
caattcgcatacaacaactagaagaagaag |
4144151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University