View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_high_85 (Length: 275)
Name: NF16177_high_85
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_high_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 32874685 - 32874508
Alignment:
| Q |
19 |
taaacataattgaccatgtttgtggctagtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcagtgtctgaaatcacaagaaattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874685 |
taaacataattgaccatgtttgtggctagtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcagtgtctgaaatcacaagaaattt |
32874586 |
T |
 |
| Q |
119 |
tgagcgtttctgggagaaccacgtaatatctaccagatagtggtgccaagaaatttgtaaaatggaggcaacctacac |
196 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32874585 |
tgagcgtttctgggagaacgacgtaatatctaccagatagtggtgtcaagaaatttgtaaaatggaggcaacctacac |
32874508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 226 - 266
Target Start/End: Complemental strand, 32874478 - 32874438
Alignment:
| Q |
226 |
tattttactttattattgtatatgattgaacctattcatct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874478 |
tattttactttattattgtatatgattgaacctattcatct |
32874438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University