View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_high_95 (Length: 252)
Name: NF16177_high_95
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_high_95 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 5 - 163
Target Start/End: Original strand, 47510432 - 47510590
Alignment:
| Q |
5 |
gatgtcgaagaatatgctatgaaattttggtatactctgatagtttgtggatttttctaattaacgttcaagttaaagtgagtgtgagtaaaaaatataa |
104 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47510432 |
gatgtcaacgaatatgctatgaaattttggtataatctgacagtttgtggatttttctaattaacgttcaagttaaagtgagcgtgagtaaaaaatataa |
47510531 |
T |
|
| Q |
105 |
ccatcttttcattttttaagagctcttagaatttaactcatctaaactttatgtttaag |
163 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47510532 |
ccatcttttcagtttttaagagctcttagaatttaactcatctaaactttatgtttaag |
47510590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 173 - 252
Target Start/End: Original strand, 47510617 - 47510696
Alignment:
| Q |
173 |
aatgatatgggacaatcacaattggtagcaccccaaaataaaatcacatttgctagcatgccaatttgttgattctttat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47510617 |
aatgatatgggacaatcacaattggtagtaccccaaaataaaatcacatttgctagcatgccaatttgttgattctttat |
47510696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University