View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_low_101 (Length: 260)
Name: NF16177_low_101
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_low_101 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 37097658 - 37097420
Alignment:
| Q |
13 |
aatattctcctatgttctaaatttcgttaatgcatgtgatttttgg---------gtctacttagcaatggagacatcttggttgtttctcaagtcttgc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37097658 |
aatattctcctatgttctaaatttcgttaatgcatgtgatttttggtctttttgggtctacttagcaatggagacatcttggttgtttctcaagtcttgc |
37097559 |
T |
 |
| Q |
104 |
catcatcaagcacttttgaacaaggtagcaaaaattactactacgtcactcatgtatatgtatattgtttttgagaatggtgtaattagaactgaagttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37097558 |
catcatcaagcacttttgaacaaggtagcaaaaattactactacgtcactcatgtatatgtatattgtttttgagaatggtgtaattagaactgaagttt |
37097459 |
T |
 |
| Q |
204 |
atatgtatatgtagatggaagatggtgtgagggagagaa |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37097458 |
atatgtatatgtagatggaagatggtgtgagggagagaa |
37097420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 64 - 147
Target Start/End: Complemental strand, 37091260 - 37091177
Alignment:
| Q |
64 |
cttagcaatggagacatcttggttgtttctcaagtcttgccatcatcaagcacttttgaacaaggtagcaaaaattactactac |
147 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
37091260 |
cttagcaagggagatatcttggttgtttctcaagccttgccatcatcaagcactttttctgaaggtaacaaaaattactactac |
37091177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University