View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_low_108 (Length: 246)
Name: NF16177_low_108
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_low_108 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 51875527 - 51875757
Alignment:
| Q |
1 |
ttgtgctattctcatgttgtatgtgctttgtacaacggattggaatgatcaaattgaaagagcaaagaatctcacaaaagctactactaccattggtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51875527 |
ttgtgctattctcatgttgtatgtgctttgtacaacggattggaatgatcaaattgaaagagcaaagaatctcacaaaagctactactaccattggtttt |
51875626 |
T |
 |
| Q |
101 |
tctgattctac---attcatcacaaaaacagtactgcgtcatgataacaacaacaataaatgtggttgtcttgaagagatcatagtaatcacacatgatg |
197 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51875627 |
tctgattctactacattcatcacaaaaacagtactgcgtcatgataacaacaacaataaatgtggttgtcttgaagagatcatagtaatcacacatgatg |
51875726 |
T |
 |
| Q |
198 |
atgctaccaagacatgtgcacactcacttga |
228 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
51875727 |
atgctaccaagacatgtacacactcacttga |
51875757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University