View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_low_126 (Length: 219)
Name: NF16177_low_126
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_low_126 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 31 - 198
Target Start/End: Complemental strand, 35072626 - 35072459
Alignment:
| Q |
31 |
ataatactagtgattgataatgacgatgaacgtatgaggaaagtaaagcatcatgacaacttgcttagcttgaggatagaatttgcaacgtaaacaaaaa |
130 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35072626 |
ataatacaagtgattgataatgacgatgaacgtatgaggaaagtaaagcatcatgacaacttgcttagcttgaggatagaatttgcaacgtaaacaaaaa |
35072527 |
T |
 |
| Q |
131 |
tcagaaataccaccaaaaatgtttgctataacaatttgggtaagaaacctagtagttgtgttcactat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35072526 |
tcagaaataccaccaaaaatgtttgctataacaatttgggtaagaaacctagtagttgtgttcactat |
35072459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University