View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_low_127 (Length: 217)
Name: NF16177_low_127
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_low_127 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 6 - 172
Target Start/End: Original strand, 12263703 - 12263866
Alignment:
| Q |
6 |
acctgcattagagatgcatatgggtattcatgggcatgcgtagcatgatatatttgtcccatcctcgatgaataaatatgatatatgcactcgaccaatt |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
12263703 |
acctgcattagagatgcatatgcgtattcatgggcaagcgtagcatgatatatttgtgccatcctcggtgaataaatattatatatgcactcaacca--- |
12263799 |
T |
 |
| Q |
106 |
atatctgtgaggtatgatgttgagggagggatagattgatgtggtagagggagttggtgtgtacccc |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
12263800 |
atatctgtgaggtatgatgttgagggagggataaattgatgtggtggagggagttggtgtgtacccc |
12263866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University