View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_low_129 (Length: 206)
Name: NF16177_low_129
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_low_129 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 66 - 198
Target Start/End: Complemental strand, 41059058 - 41058926
Alignment:
| Q |
66 |
gtcatggtttaaacattgtgcgtgattttaaaccctattgactttaagaatcatttgcatgtttttaatttcagaatttgaataatctgtgcacaaaaat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41059058 |
gtcatggtttaaacattgtgcgtgattttaaaacctattgactttaagaatcatttgcatgtttttaatttcagaatttgaataatctgtgcacaaaaat |
41058959 |
T |
 |
| Q |
166 |
tgtagtttttgtgtgtgcatttgctgatgatgt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41058958 |
tgtagtttttgtgtgtgcatttgctgatgatgt |
41058926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University