View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_low_21 (Length: 510)
Name: NF16177_low_21
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 387; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 7 - 430
Target Start/End: Original strand, 3342596 - 3343025
Alignment:
| Q |
7 |
aatattggatcgtgtttgtgcatggagagttggggaattcttcataacataaaattagcaaatgtggactccgactcaactgtggcaatcaagttattgc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3342596 |
aatattggatcgtgtttgtgcatggagagttggggaattcttcataacataaaattagcaaatgtagactccgactcaactgtggcaatcaagttattgc |
3342695 |
T |
 |
| Q |
107 |
agcattgaacaccatgcttctcaactagttaaaacaatccattgtctagtttaaagggtactgtgatttggtggcaacgcattctatgggaggctcaata |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342696 |
agcattgaacaccatgcttctcaactagttaaaacaatccattgtctagtttaaagggtacggtgatttggtggcaacgcattctatgggaggctcaata |
3342795 |
T |
 |
| Q |
207 |
taatttatcagttattgataatctcaaagtttttgaatcagttccaaatttgagcataaaaagggtatttaaacttttcatcaaacatcttttggaaaat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
3342796 |
taatttatcagttattgataatctcaaagttttttaatcagttccaaatttgagcataaaaagggtatttaaacttttcatcaaacaacatttggaaaat |
3342895 |
T |
 |
| Q |
307 |
agaaatgcacaattgtttcat------aaaaaagatgatttatcatgcaagattctcgttattggcatcgttagtctattaattttatgcaaatagataa |
400 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342896 |
agaaatgcacaattgtttcataaaaaaaaaaaagatgatttatcatgcaagattctcgttattggcatcgttagtctattaattttatgcaaatagataa |
3342995 |
T |
 |
| Q |
401 |
cgacaagaactatgggattgttcaataggt |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3342996 |
cgacaagaactatgggattgttcaataggt |
3343025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University