View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_low_56 (Length: 354)
Name: NF16177_low_56
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_low_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 208 - 338
Target Start/End: Complemental strand, 45705710 - 45705572
Alignment:
| Q |
208 |
gtatcgttatcttctgagaagcttctggtaaaccagttccaatcgtgtgtacgtcatccactacccctaacttagcctaacgtgttcc--------taca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
45705710 |
gtatcgttatcttctgagaagcttctggtaaaccagttccaatcgtgtgtacgtcatccactaccccttacttagcctaacgttttccctatctgataca |
45705611 |
T |
|
| Q |
300 |
acttcgtatgtcaattgcaaacactctgatttgctctat |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45705610 |
acttcgtatgtcaattgcaaacactctgatttgctctat |
45705572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University