View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_low_69 (Length: 327)
Name: NF16177_low_69
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_low_69 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 42615969 - 42615768
Alignment:
| Q |
1 |
gcatatgaggatatggtacatctatgtttggtcttgttggtatgttacttcttttttgtttatgtaagttttcaaccattgaatgtgttgttttcgttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42615969 |
gcatatgaggatatggtacatctatgtttggtcttgttggtatgttacttcttttttgtttatgtaagttttcaactattgaatgtgttgttttcgttta |
42615870 |
T |
|
| Q |
101 |
tcgggtgttaattcgatgataagagtttgatattaaaacttcaagcagccgagttcaaatttcatctagaatagttgtcagtatcactttaattaataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42615869 |
tcgggtgttaattcgatgataagagtttgatattaaaacttcaagcagccgagttcaaatttcatctagaatagttgtcagtatcactttaattaataat |
42615770 |
T |
|
| Q |
201 |
aa |
202 |
Q |
| |
|
|| |
|
|
| T |
42615769 |
aa |
42615768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 233 - 315
Target Start/End: Complemental strand, 42615737 - 42615655
Alignment:
| Q |
233 |
aaatatattgttcctgtgattggagcttggaaggggagggtcatgatgtgggtaagagacaaaaggaattggcaaggaatatt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42615737 |
aaatatattgttcctgtgattggagcttggaaggggagggtcatgatgtgggtaagagacaaaaggaattggcaaggaatatt |
42615655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University