View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16177_low_70 (Length: 326)

Name: NF16177_low_70
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16177_low_70
NF16177_low_70
[»] chr2 (2 HSPs)
chr2 (115-308)||(14707794-14707990)
chr2 (15-116)||(14707433-14707536)


Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 115 - 308
Target Start/End: Original strand, 14707794 - 14707990
Alignment:
115 tataaatttcatcaacatagaagtaacgaaacaaca---acaacatcattgatgatttactagtttctaggattttctatgaatagagagtaggaaggat 211  Q
    ||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
14707794 tataaatttcatcaacatagaagtaacgaaacaacataaacaacatcattgatgatttactagtttctaggattttctatgaatagagagtagcaaggat 14707893  T
212 tcttgagatttattggaaactctagcgcaaaacattagtctcacatgatacataaaggggattttaatgacatgaatcgaatagagataaacgaaat 308  Q
    |||||  |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||||    
14707894 tcttggaatttattgcaaactctagcgcaaaacattagtctcacatggtacataaaggggattttaattacatcaatcgaatagagataaacgaaat 14707990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 14707433 - 14707536
Alignment:
15 ttggttttggtggagcc-tttg-agttgatcctgttggcagaagcggtggacttgattgcatgtggaggcaaccttttcaatgtaaacttgataaattat 112  Q
    ||||||||||||||||| |||| |||||||| |||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
14707433 ttggttttggtggagccatttgcagttgatcgtgttggtagaagcggtggacttgattgcctgtggaggcaaccttttcaatgtaaacttgataaattat 14707532  T
113 gcta 116  Q
    ||||    
14707533 gcta 14707536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University