View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16177_low_82 (Length: 302)
Name: NF16177_low_82
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16177_low_82 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 37702485 - 37702772
Alignment:
| Q |
1 |
cgttgattggtggacacattacacgtgattgtggactctattgatggcattaataatttgtgcgtgcaagagagcataaaatgataaaagattattgctg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37702485 |
cgtttattggtggacacattacacgtgattgtggactctattgatggcattaataatttgtgcgtgcaagagagcataaaatgataaaagattattgctg |
37702584 |
T |
 |
| Q |
101 |
tatatatagtgtgattcttgcctcgtgtggaaatgcatgtcttatttttattcaacaacaacaaattcaaaaggaagatagatacactttgcaccccatt |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37702585 |
tata----gtgtgattcttgcctcgtgtggaaatgcatgtcttatttttattcaacaacaacaaattcaaaaggaagatagatacactttgcaccccatt |
37702680 |
T |
 |
| Q |
201 |
atcattggtctctaagaccccaagattctctatgtctctccacacgttcaagggattgatctcaaaggttataaagatcttttttcttttctt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37702681 |
atcattggtctctaagaccccaagattctctatgtctctccacacgttcaagggattaatctcaaaggttataaagatc-tttttcttttctt |
37702772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University