View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16178_high_6 (Length: 336)
Name: NF16178_high_6
Description: NF16178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16178_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 14564969 - 14565288
Alignment:
| Q |
1 |
cttggtaatatcatggtttctttctgcgaagatcaggatcatgtttggtaaatgtgatcggactgagaagattgaggctgaaaatatcttgcaaaccaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14564969 |
cttggtaatatcatggtttctttctgcgaagatcaggatcatgtttggtaaatgtgatcggactgagaagattgaggctgaaaatatcttgcaaaccaag |
14565068 |
T |
|
| Q |
101 |
aaacttcgaaagagaggagtgtgggttttatgtattccaggtgttgctgaaggtgtatgtattttgcacaagattaaatatattgtttaacatgttatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14565069 |
aaacttcgaaagagaggagtgtgggttttatgtattccaggtgttgctgaaggtgtatgtattttgcacaagattaaatatattgtttaacatgttatga |
14565168 |
T |
|
| Q |
201 |
cgattccaactatcaaatactagatgaatgttgtctagtagggaggcataccttcactctccagatgattctttttatcgatgaatgacttgcgagctgc |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14565169 |
cgattccaactatc-aatactagatgaatgttgtctagtagggaggcataccttcactctccagatgattctttttatcggtgaatgacttgcgagctgc |
14565267 |
T |
|
| Q |
301 |
caaatgatcttccagattcta |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
14565268 |
caaatgatcttccagattcta |
14565288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University