View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16179_low_7 (Length: 299)
Name: NF16179_low_7
Description: NF16179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16179_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 102 - 275
Target Start/End: Original strand, 18946281 - 18946454
Alignment:
| Q |
102 |
atatcagataaccagactaacgaaaaataacaaaacagatcaattaataggtccaacaatgttagcaagctagatcaattgaatatataaaacgtttata |
201 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
18946281 |
atatcagataaccaaactaacgaaaaataacaaaacagatcaattaataggtccaacaatgttagcaagctagatcaattgaatatttaaaacatttata |
18946380 |
T |
|
| Q |
202 |
tgaagcagtcttattgacagaatataccgaatatccacacttaacattcaaccaacaaatctatagcttgaatt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18946381 |
tgaagcagtcttattgacagaatataccgaatatccactcttaacattcaaccaacaaatctatagcttgaatt |
18946454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 13 - 88
Target Start/End: Original strand, 18946156 - 18946231
Alignment:
| Q |
13 |
tttctttgacgcacctatgacagtttcgatgtcatggtcaatgcagttgtattttatacatatttaatttacaaat |
88 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18946156 |
tttctttgacgcacctatgacagttttgatgtcatggtcaatgcaattgtattttatacatatttaatttacaaat |
18946231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University