View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1617_high_10 (Length: 251)
Name: NF1617_high_10
Description: NF1617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1617_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 59 - 243
Target Start/End: Original strand, 53539265 - 53539449
Alignment:
| Q |
59 |
cattaaaagatccaccatgactgtttagtttattatggttgtgtagacattgattattgcagtgctcaaggatagtctatttaaccaatgtcataattta |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
53539265 |
cattaaaagatccaccatgactgtttagtttattatggttgtgtagacattgattattgcagtgctcaagaatagtctatttaaccaatgtcataactta |
53539364 |
T |
 |
| Q |
159 |
gcatttaacattttgctgctaccaatatttagttctctatcctacctgaccacaatattctaaaacatttttctacatctctgct |
243 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
53539365 |
gcatttaacattttcctgctaccaatattcagttctctatcctacctgaccacaatattctaaaacatagttctacatctttgct |
53539449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 10603890 - 10603861
Alignment:
| Q |
1 |
tcacttgagtttatcaggttttgaatgttt |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10603890 |
tcacttgagtttatcaggttttgaatgttt |
10603861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University