View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1617_low_14 (Length: 237)
Name: NF1617_low_14
Description: NF1617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1617_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 221
Target Start/End: Complemental strand, 45803873 - 45803662
Alignment:
| Q |
10 |
tagattatactgggaaactcatagataatatttgaaccattatgttgtgttatgataatacttgaccattgattgattcttcttcactatataggcaaca |
109 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45803873 |
tagattctattgggaaactcatagataatatttgaaccattatgttgtgttatgataatacttgaccattgattgattcttcttcactatataggcaaca |
45803774 |
T |
 |
| Q |
110 |
gcatttggcatgaaaagtgtcgtgtacgtgccgcgaatcaaattagatacggttgcagcattatctgcattctgtgagaaggccagcatggtgagcaagg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45803773 |
gcatttggcatgaaaagtgtcgtgtacgtgccgcgaatcaaattagatacggttgcagcattatctgcattctgtgagaaggccagcatggtgagcaagg |
45803674 |
T |
 |
| Q |
210 |
ggtgagacttat |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45803673 |
ggtgagacttat |
45803662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University