View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1617_low_15 (Length: 217)

Name: NF1617_low_15
Description: NF1617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1617_low_15
NF1617_low_15
[»] chr3 (1 HSPs)
chr3 (25-166)||(53538451-53538592)


Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 25 - 166
Target Start/End: Complemental strand, 53538592 - 53538451
Alignment:
25 ttgaatgaattatagaaggaaggttaagtgaccatgtaggctccatgtcctcacttgatcaaaggcttcaacaatcatatgatgaggattagaattagat 124  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
53538592 ttgaatgaattatagaaggaaggttaggtgaccatgtaggctccatgtcctcacttgatcaaaggcttcaacaatcatatgatgagggttagaattagat 53538493  T
125 ggcagagctcactattgaaaatcagcactatcattctttata 166  Q
    ||||||||||||||||||||||||||||||||||||||||||    
53538492 ggcagagctcactattgaaaatcagcactatcattctttata 53538451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University