View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1617_low_15 (Length: 217)
Name: NF1617_low_15
Description: NF1617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1617_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 25 - 166
Target Start/End: Complemental strand, 53538592 - 53538451
Alignment:
| Q |
25 |
ttgaatgaattatagaaggaaggttaagtgaccatgtaggctccatgtcctcacttgatcaaaggcttcaacaatcatatgatgaggattagaattagat |
124 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53538592 |
ttgaatgaattatagaaggaaggttaggtgaccatgtaggctccatgtcctcacttgatcaaaggcttcaacaatcatatgatgagggttagaattagat |
53538493 |
T |
 |
| Q |
125 |
ggcagagctcactattgaaaatcagcactatcattctttata |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53538492 |
ggcagagctcactattgaaaatcagcactatcattctttata |
53538451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University