View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16180_high_8 (Length: 254)
Name: NF16180_high_8
Description: NF16180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16180_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 2 - 231
Target Start/End: Original strand, 9072780 - 9073009
Alignment:
| Q |
2 |
gaggaacggagcacctccgggccgtgcagccaatgcctgcatgaatgcaggccattggtagccttgaaggatatcaaggtcgatgacatggacacgctct |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072780 |
gaggaacggagcacctccgggccgtgcagccaatgcctgcatgaatgcaggccattggtagccttgaaggatatcaaggtcgatgacatggacacgctct |
9072879 |
T |
 |
| Q |
102 |
tccgcctcaaacgcctcgaaaatggcttggttagcggtaaagtgtgcgaatttgatgtaagggcaagcttggtagacaatttggtatatcttgaggactt |
201 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072880 |
tcagcctcaaacgcctcgaaaatggcttggttagcggtaaagtgtgcgaatttgatgtaagggcaagcttggtagacaatttggtatatcttgaggactt |
9072979 |
T |
 |
| Q |
202 |
ccatagggtttgatgggaaggtagataaac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9072980 |
ccatagggtttgatgggaaggtagataaac |
9073009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University