View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16181_high_8 (Length: 342)
Name: NF16181_high_8
Description: NF16181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16181_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 82 - 291
Target Start/End: Original strand, 42909918 - 42910127
Alignment:
| Q |
82 |
gtagttagaaatttcaaattacatttttgaagatcgaatcttcgagtgattgtccaaccgatcacatcccatatgcagattgtgcagtcttcagaagacg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42909918 |
gtagttagaaatttcaaattacatttttgaagatcgaatcttcgagtgattgtccaaccgatcacatcccatatgcagattgtgcagtcttcagaagacg |
42910017 |
T |
 |
| Q |
182 |
atattaggcatgtccgactagatgccattgcagtaatggctcccctgcaaagttgacagaaaagcaagctcacaattatacacaataattaacttcttta |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42910018 |
atattaggcatgtccgactagatgccattgcagtaatggctcccctgcaaagttgacagaaaagcaagctcacaattatacacaataattaacttcttta |
42910117 |
T |
 |
| Q |
282 |
cataactatt |
291 |
Q |
| |
|
|||||||||| |
|
|
| T |
42910118 |
cataactatt |
42910127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University