View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16181_low_17 (Length: 249)
Name: NF16181_low_17
Description: NF16181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16181_low_17 |
 |  |
|
| [»] scaffold0421 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0421 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0421
Description:
Target: scaffold0421; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 26 - 238
Target Start/End: Original strand, 12223 - 12435
Alignment:
| Q |
26 |
tgttgctaccttccgccatgttcaggatgtttaccagatcaggtacataaatgtttccttcttatcttgatctaaacgccaaagaattcactccatttag |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12223 |
tgttgctaccttccgccatgttcaggatgtttactagatcaggtacataaatgtttccttcttatcttgatctaaacgccaaagaattcactccatttag |
12322 |
T |
 |
| Q |
126 |
aattatgattcagtttatttcgtttctgtgcagctggtctacagacagtagactattattgagttgcagcagtgattctacattgaaggtaagcgtaatt |
225 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12323 |
aattatgattcagtttattttgtttctgcgcagctggtctgcagacagtagactattattgagttgcagcagtgattctacattgaaggtaagcgtaatt |
12422 |
T |
 |
| Q |
226 |
tcccctttcttca |
238 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12423 |
tcccctttcttca |
12435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University