View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16181_low_22 (Length: 205)
Name: NF16181_low_22
Description: NF16181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16181_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 7e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 15446540 - 15446719
Alignment:
| Q |
12 |
actgagatgaaactcaaagatggaggacggtgaacccaaaaacaaatgttttaaattaaagagattagcaaaatgtc-gatgggtcacaactccagagag |
110 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15446540 |
actgggatcaaactcaaagatggaggacggtgaacccaaaaacaaatgttttaaattaaagagattagcaaaatgtctgatgggtcacaactccagagag |
15446639 |
T |
 |
| Q |
111 |
tgaattttctccaacacccaataccttcaaattcgagaggttccccaaactttgaggaaggttaccggtcaagttatttg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15446640 |
tgaattttctccaacacccaataccttcaaattcgagaggttccccaaactttgaggaaggttaccggtcaagttatttg |
15446719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 97 - 188
Target Start/End: Original strand, 18052369 - 18052460
Alignment:
| Q |
97 |
acaactccagagagtgaattttctccaacacccaataccttcaaattcgagaggttccccaaactttgaggaaggttaccggtcaagttatt |
188 |
Q |
| |
|
|||| |||||| || ||||||||||||||| |||| |||| ||||||||| || | ||||||||||| ||||||| || | ||||||||||| |
|
|
| T |
18052369 |
acaattccagatagagaattttctccaacatccaacacctccaaattcgatagttgccccaaactttcaggaaggctatcagtcaagttatt |
18052460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University