View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16181_low_23 (Length: 202)
Name: NF16181_low_23
Description: NF16181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16181_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 23 - 166
Target Start/End: Original strand, 8162327 - 8162470
Alignment:
| Q |
23 |
tgcgatcaaacaccgtaaacatgctcaagactgtcattggttgctgcgtatattgcaatctatcttttagattgttatttgtcactatgtgtatcttgtc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
8162327 |
tgcgatcaaacaccgtaaacatgctcaaggccgtcattggttgctgcatatattgcaatctatcttttagattgttatttgtaaccatgtgtatcttgtc |
8162426 |
T |
 |
| Q |
123 |
ttggaaataatgtgttaatctaaacccctgaaatatggaatttg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8162427 |
ttggaaataatgtgttaatctaaacccctgaaatatggaatttg |
8162470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University