View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16182_low_14 (Length: 260)
Name: NF16182_low_14
Description: NF16182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16182_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 235
Target Start/End: Original strand, 36828703 - 36828924
Alignment:
| Q |
15 |
aagacaggagaactggttttactcaaaaccgaaaagctaggtataaatgtgtaagagtagactctaagacagaactcacagttcacgcagagtata-atg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36828703 |
aagacaggagaactggttttactcaaaatcgaaaagctaggtataattgtgtaagagtagactctaagacagaactcacagttcacgcagagtattgatg |
36828802 |
T |
|
| Q |
114 |
gagaatcaaacaaaccagagtcatgtttgaggggatgaggcattcttcatgttaacgatacttcactcacctttttatctttggattatttagatcagac |
213 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
36828803 |
gagaaccaaacaagccagagtcatgtttgaggggatgaggcattcttcatgttaacgatacttcactcacctttttatctctagattatttagatcagac |
36828902 |
T |
|
| Q |
214 |
accacaagaattgcattaataa |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36828903 |
accacaagaattgcattaataa |
36828924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University