View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16182_low_20 (Length: 234)
Name: NF16182_low_20
Description: NF16182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16182_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 34105657 - 34105860
Alignment:
| Q |
19 |
cactttagatcccaagttgaagaatcctcatttgcttggggatcattgtccaacatctatagaatgcagatgatattctcatatggtttgtgctaacttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34105657 |
cactttagatcccaagttgaagaatcctcatttgcttgggga--atagtccaacatctatagaatgcagatgatattctcatatggtttgtgctaacttg |
34105754 |
T |
 |
| Q |
119 |
gcttaaggttaattttaactagtattttgtaggtcaatgtaaagaaatcattcttatctatagcatcagatttcctatattgtagggtagggtattttcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34105755 |
gcttaaggttaattttaactagtattttgtaggtctatgtaaaggaatcattcttatctatagcatcagatttcctatattgtagggtagggtattttcc |
34105854 |
T |
 |
| Q |
219 |
attcat |
224 |
Q |
| |
|
|||||| |
|
|
| T |
34105855 |
attcat |
34105860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University