View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16184_high_8 (Length: 218)
Name: NF16184_high_8
Description: NF16184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16184_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 26 - 196
Target Start/End: Original strand, 49254768 - 49254938
Alignment:
| Q |
26 |
tggttcaagaagcataacatggcgtgtattttttcaagaggtgaaagatgtttgttttctagcattgcctatgattagtgtaactttgtcacaatatttt |
125 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49254768 |
tggttcaagaagcataacatggggtgtattttttcaagaggtgaaagatgtttgttttctagcattgcctatgattagtgtaactttgtcacaatatttt |
49254867 |
T |
|
| Q |
126 |
ctacaaattatttcaatgatgatggttggtcatttgtgtaaactttctctttctagcacagctattgctat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49254868 |
ctacaaattatttcaatgatgatggttggtcatttgggtaaactttctctttctagcacagctattgctat |
49254938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 24 - 196
Target Start/End: Original strand, 49267028 - 49267200
Alignment:
| Q |
24 |
ggtggttcaagaagcataacatggcgtgtattttttcaagaggtgaaagatgtttgttttctagcattgcctatgattagtgtaactttgtcacaatatt |
123 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| || ||| |||||||||||| |
|
|
| T |
49267028 |
ggtgattcaagaagcataacatggggtgtattttttcaagaggtgaaagatgtttgttttctagctctgcctatgatcgccgtcactctgtcacaatatt |
49267127 |
T |
|
| Q |
124 |
ttctacaaattatttcaatgatgatggttggtcatttgtgtaaactttctctttctagcacagctattgctat |
196 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
49267128 |
ttctacaaattatttcaatgataatggttggtcgtttgggtaaacttgctctttctagcacagctattgctat |
49267200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 37 - 196
Target Start/End: Original strand, 49271447 - 49271606
Alignment:
| Q |
37 |
gcataacatggcgtgtattttttcaagaggtgaaagatgtttgttttctagcattgcctatgattagtgtaactttgtcacaatattttctacaaattat |
136 |
Q |
| |
|
||||| ||||| |||| ||| |||||||||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49271447 |
gcatatcatggggtgtgtttgttcaagaggtagaagatgttggttttctagctttgcctatgattagtgtaactttgtcacaatattttctacaaattat |
49271546 |
T |
|
| Q |
137 |
ttcaatgatgatggttggtcatttgtgtaaactttctctttctagcacagctattgctat |
196 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
49271547 |
ttcaatgatgatggttggtcatttgggtaaacttgctctttctaccacagctattgctat |
49271606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 73 - 194
Target Start/End: Complemental strand, 49274761 - 49274640
Alignment:
| Q |
73 |
atgtttgttttctagcattgcctatgattagtgtaactttgtcacaatattttctacaaattatttcaatgatgatggttggtcatttgtgtaaactttc |
172 |
Q |
| |
|
||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49274761 |
atgttggttttctagctttgcctatgactagtgtaactttgtcacaatattttctacaaattatttcaatgatgatggttggtcatttgggtaaactttc |
49274662 |
T |
|
| Q |
173 |
tctttctagcacagctattgct |
194 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49274661 |
tctttctagcacagctattgct |
49274640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University