View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16184_low_11 (Length: 202)
Name: NF16184_low_11
Description: NF16184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16184_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 45 - 187
Target Start/End: Complemental strand, 34366280 - 34366138
Alignment:
| Q |
45 |
gtgcagacctaatcttcacttaattaaacctaatccaaaattataagacaatatcaaatctatcaaaaatttatcaaaacttgcattacaactaatttga |
144 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34366280 |
gtgcagacctaatcttcactcaattaaacctaatccaaaattataagatggcatcagatctatcaaaaatttatcaaaacttgcattacaactaatttga |
34366181 |
T |
 |
| Q |
145 |
atatatactataaaacattaatttcaaagtggaccatgcatgt |
187 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34366180 |
atgtatactataaaacattaatttccaagtggaccatgcatgt |
34366138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University