View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16188_low_3 (Length: 298)
Name: NF16188_low_3
Description: NF16188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16188_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 294
Target Start/End: Complemental strand, 56320442 - 56320167
Alignment:
| Q |
19 |
gttggaaagttgaggaccaaccaaatggcgaaccctgtgaacagcttccatgacggaattgtagagattgtcgataatggaaactgtatagccctgtttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56320442 |
gttggaaagttgaggaccaaccaaatggcgaaccctgtggacagcttccatgacggaattgtagagattgtcgataatggaaactgtatagccctgtttt |
56320343 |
T |
|
| Q |
119 |
agaagctgaacaaccgtgtgtgatccaatgaaccccgccccaccggttaccattatcgttttcctttccgacgattggtactgcccactcaccatctctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56320342 |
agaagctgaacaaccgtgtgtgatccgatgaaccccgccccaccggttaccattatcgttttcctttccgacgattggtactgcccactcaccatctctt |
56320243 |
T |
|
| Q |
219 |
tccaattcctaattccctctctccatggcctcatttttataacaccggccctgatttcaacattatttcaaattga |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
56320242 |
tccaattcctaattccctctctccatggcctcatttttataacaccagccctgctttcaacattatttcaaattga |
56320167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University