View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16188_low_4 (Length: 202)
Name: NF16188_low_4
Description: NF16188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16188_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 31610205 - 31610045
Alignment:
| Q |
20 |
tcgagacacctccattctggttcacggtcagcaaatatcataaccattgtatggaatgcttccaatgcccatgcgagacttgttagtacgaaatgcttta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31610205 |
tcgagacacctccattctggttcacggtcagcaaatatcataaccattgtatggaatgcttccaatgcccatgcgagacttgttagtacgaaatgcttta |
31610106 |
T |
|
| Q |
120 |
gctgccaccgtccgaactcgccgcagtagttttgtagcatctcgtcgatgcattgtttctc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31610105 |
gctgccaccgtccgaactcgccgcagtagttttgtagcatctcgtcgatgcattgtttctc |
31610045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 171
Target Start/End: Original strand, 34422475 - 34422599
Alignment:
| Q |
47 |
tcagcaaatatcataaccattgtatggaatgcttccaatgcccatgcgagacttgttagtacgaaatgctttagctgccaccgtccgaactcgccgcagt |
146 |
Q |
| |
|
|||||||| ||||||||||| ||||| || |||||||| ||||| || |||||||| || | ||| || || |||||||| ||| ||||| || |||| |
|
|
| T |
34422475 |
tcagcaaaaatcataaccatagtatgaaaagcttccaacgcccaagcaagacttgtgagaatgaagtgtttcagctgccattttccaaactcaccacagt |
34422574 |
T |
|
| Q |
147 |
agttttgtagcatctcgtcgatgca |
171 |
Q |
| |
|
| || | |||||||| |||||||| |
|
|
| T |
34422575 |
atttctcaagcatctcatcgatgca |
34422599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University