View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1618_high_6 (Length: 239)
Name: NF1618_high_6
Description: NF1618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1618_high_6 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 34 - 239
Target Start/End: Original strand, 13505871 - 13506076
Alignment:
| Q |
34 |
tattcctcctaaactttttgaaagttttgaaattggctattgattaatacataaaaatagagtgatatatgtaatatgcaagtgttggatgtcaaaatat |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13505871 |
tattcctcctaaactttttgaaagttttgaaattggctattgattaatacataaaaatagagtgatatatgtaatatgaaagtgttggatgtcaaaatat |
13505970 |
T |
|
| Q |
134 |
gtgggacgatgctttcttttcaatatgcaaggtactttctccccgtttcatataatcgctcttgtgaacaaatgtcaatagnnnnnnntgagaatgtaaa |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13505971 |
gtgggacgatgctttcttttcaatatgcaaggtactttctccccgtttcatataatcgctcttgtgaacaaatgtcaatagaaaaaaatgagaatgtaaa |
13506070 |
T |
|
| Q |
234 |
acttac |
239 |
Q |
| |
|
|||||| |
|
|
| T |
13506071 |
acttac |
13506076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 13505831 - 13505871
Alignment:
| Q |
18 |
tgctcatccttctgtatattcctcctaaactttttgaaagt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13505831 |
tgctcatccttctgtatattcctcctaaactttttgaaagt |
13505871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University