View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1618_low_3 (Length: 346)
Name: NF1618_low_3
Description: NF1618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1618_low_3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 15 - 346
Target Start/End: Original strand, 36947098 - 36947429
Alignment:
| Q |
15 |
accttttgcttctaacatggatatcactacaataacaaacacaagtaccattcactgcctaaacaaaaaagagacttgggtgctattttgaaaaagaaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36947098 |
accttttgcttctaacatggatatcactacaataacaaacacaagtaccattcactgcctaaacaaaaaagagacttggctgctattttgaaaaagaaaa |
36947197 |
T |
 |
| Q |
115 |
atgatcaccttgattcattagagagatagcagcactaagagaggcatttggccttagagttgcaattggctgtttattggattcccccacttttggcgcc |
214 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947198 |
attatcaccttgattcattagagagatagcagcactaagagaggcatttggccttagcgttgcaattggctgtttattggattcccccacttttggcgcc |
36947297 |
T |
 |
| Q |
215 |
catgtacccaaaggtattgaaccaattggtagttgaagaaccggcaaagagccataatcgttcttgcaatgcttgcatatacctgaaaattaactccata |
314 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
36947298 |
catgtacccaaaggtatcgaaccaattggtagttgaagaaccggcaaagagccataatcgttcttgaaatgcttgcatatacctgaaaattaactccgta |
36947397 |
T |
 |
| Q |
315 |
cattagttccaaaccatttatgcgcaatgcca |
346 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
36947398 |
cattagttccaaaccatttatgcgcattgcca |
36947429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University