View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16192_high_6 (Length: 270)
Name: NF16192_high_6
Description: NF16192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16192_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 44120072 - 44120290
Alignment:
| Q |
1 |
cagataaatcattaatatttaatttactgtttaggccctcagcgtggtaagttgttggatg--------aaattttcgaaaaaactattacctatccgaa |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
44120072 |
cagataaatcattaatatttaatttactgtttaggccctcagcgtgttaagttgttggatccacctataaaattttcgaaaaaaccattacctatccgaa |
44120171 |
T |
 |
| Q |
93 |
cattgtattagaccccatgaccactcattaa-ctacacacataatcctgaccaatcttcgtgagaaccatcaccgcaacaatgccttaattttatctacg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44120172 |
cattgtattagaccccatgaccactcattaaactacacacataatcctgaccaatcttcgtgagaaccatcaccgcaacaatgccttaattttatctatg |
44120271 |
T |
 |
| Q |
192 |
acttctctagcatgcgtag |
210 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44120272 |
acttctctagcatgcgtag |
44120290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University