View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16192_low_6 (Length: 280)
Name: NF16192_low_6
Description: NF16192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16192_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 15 - 264
Target Start/End: Original strand, 2563277 - 2563527
Alignment:
| Q |
15 |
gacccatcttatctattcactcgtcaacccaactgtacatggccaagtatgtcttaatcaatagcaattaaagtttataaacgggggcacaagaaaa-ca |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2563277 |
gacccatcttatctattcacttgtcaacccaactgtacatggccaagtatgtcttaatcaatagcaattaaagtttataaacgggggcacaagaaaaaca |
2563376 |
T |
 |
| Q |
114 |
aattaaaacggcagacatatatatcataaaaatattgcacttgtcaaatctgtgaatttcttcgtaattttttcctaatgtttaaactatattgcttgct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2563377 |
aattaaaacggcagacatatatatcataaaaatattgcacttgtcaaatctgtgaatttcttcgtaattttttcctaatgtttaaactatattgcttgct |
2563476 |
T |
 |
| Q |
214 |
aaatttggttgagtgataaacagcccacagtatgtagttagatattcaatt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2563477 |
aaatttggttgagtgataaacagcccacagtatgtagttagatattcaatt |
2563527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University