View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16193_high_1 (Length: 207)
Name: NF16193_high_1
Description: NF16193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16193_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 30505566 - 30505391
Alignment:
| Q |
15 |
atgaagagagatgtggaagctaaaattagtaaatgtgagatggatatagtgaaatatcagttgaatgaaatgcaaatgtagttggaagaaacaaatcgga |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30505566 |
atgaagagcgatgtggaagctaaaattagtaaatgtaagatggatatagtgaaatatcagttgaatgaaatgcaaatgtagttggaagaaacaaatcgga |
30505467 |
T |
|
| Q |
115 |
aataatatgggctgtttgtgttgtgattttggcttttgttgtatggttgaagtaatgtatcataatatgaatttag |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30505466 |
aataatatgggctgtttgtgttgtgattttggcttttgttgtatggttgaagtaatgtatcataatatgaatttag |
30505391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 6538080 - 6538112
Alignment:
| Q |
24 |
gatgtggaagctaaaattagtaaatgtgagatg |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6538080 |
gatgtggaagctaaaattagtaaatgtgagatg |
6538112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 6538255 - 6538287
Alignment:
| Q |
24 |
gatgtggaagctaaaattagtaaatgtgagatg |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6538255 |
gatgtggaagctaaaattagtaaatgtgagatg |
6538287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University