View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16193_high_10 (Length: 358)
Name: NF16193_high_10
Description: NF16193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16193_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 345
Target Start/End: Complemental strand, 21219212 - 21218868
Alignment:
| Q |
1 |
tactcctggaatcttgattatattttactaaatagttgttttgtgcaactatagtacttgattcactgattacactatcgtacttttgatgagatctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21219212 |
tactcctggaatcttgattatattttactaaatagttgttttgtgcaactatagtacttgattcactgattacactatcgtacttttgatgagatctttt |
21219113 |
T |
 |
| Q |
101 |
agtatacagcaatgtttgactgatttgtcagctgtgctgatatatcctggttaatggatcattttatttattgttttgtgtgtatgtatgtatcgattct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21219112 |
agtatacagcaatgtttgactgatttgtcaactgtgctgatatatcctggttaatggatcattttatttattgttctgtgtgtatgtatgtatcgattct |
21219013 |
T |
 |
| Q |
201 |
ataagattttgtgtcattgtaatatacatccctaatgtaattatttgttttttgtcttctgtgctcagcggatcctaagggaatagagctcataattcct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21219012 |
ataagattttgtgtcattgtaatatacatccctaatgtaattatttgttttttgtcttctgtgctcagcggatcctaagggaatagagctcataattcct |
21218913 |
T |
 |
| Q |
301 |
gactgttgcgaagcaaggcaggttaccccaatgaagatatatttt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21218912 |
gactgttgcgaagcaaggcaggttaccccaatgaagatatatttt |
21218868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University