View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16193_low_2 (Length: 210)
Name: NF16193_low_2
Description: NF16193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16193_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 2510751 - 2510917
Alignment:
| Q |
18 |
atatacaacctcaaatagtgtcatccttttggaaatatgaaatgcgatatgagaaatgttaagtatagcgaaccaaaatttaacgaacaactcacaaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2510751 |
atatacaacctcaaatagtgtcatccttttggaaatatgaaatgcgatatgagaaatgttaagtatagcgaaccaaaatttaacgaacaactcacaaatt |
2510850 |
T |
|
| Q |
118 |
gattcannnnnnncttaaactttttggtagaaaacatgactcctttcattcacctcttcaaacacca |
184 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2510851 |
gattcatttttttcttaaactttttggtagaaaacatgactcctttcattcacctcttcaaacacca |
2510917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University