View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16194_high_11 (Length: 245)
Name: NF16194_high_11
Description: NF16194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16194_high_11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 43797776 - 43798020
Alignment:
| Q |
1 |
aatatggagtaacaaacttcattggattagttttcaggctaagagcaagcatattggtttccttagaatatactttgtaccctgttctatggcgcctttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43797776 |
aatatggagtaacaaacttcattggattagttttcaggctaagagcaagcatattggtttccttagaatgtactttgtaccctgttctatggcgcctttc |
43797875 |
T |
|
| Q |
101 |
tacagaccaaaacacatttatgaatttgtcctcatggccannnnnnnccttggaactcttaacacagtttatacagcagtctcccttgacttagggttac |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797876 |
tacagaccaaaacacatttataaatttgtcctcatggccatttttttccttggaactcttaacacagtttatacagcagtctcccttgacttagggttac |
43797975 |
T |
|
| Q |
201 |
cttctctcttcttcggataatttcttttttactagggctgtcaat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43797976 |
cttctctcttcttcggataatttcttttttactagggttgtcaat |
43798020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University