View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16194_low_13 (Length: 250)
Name: NF16194_low_13
Description: NF16194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16194_low_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 64 - 250
Target Start/End: Complemental strand, 43142752 - 43142563
Alignment:
| Q |
64 |
ttacacaattgaacgcactttgtttgagaacactaattgatggtattagtacgtagcatggttttgttctctttgccactcctctcttt---ctatgatt |
160 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
43142752 |
ttacacaattgaacgcaatttgtttgagaacactaattgatggtattagtacatagcatggttttgttctctttgccactcctctctttattctatggtt |
43142653 |
T |
|
| Q |
161 |
gtccccttttaactcacttcaaccatcattgttaatgttcgcacattctcttatgaaccacgtattttcataagagaatgtaagagcaaa |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43142652 |
gtccccttttaactcatttcaaccatcattgttaatgttcacacattctcttatgaaccacttattttcataagagaatgtaagagcaaa |
43142563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University