View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16194_low_15 (Length: 245)
Name: NF16194_low_15
Description: NF16194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16194_low_15 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 245
Target Start/End: Original strand, 38269268 - 38269506
Alignment:
| Q |
7 |
tctttatttcattgtcagtcctccccggcaattgcgccgcaatttgagaccatctgataagaagaaaatgaacataattttttaaaacggacggtattag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38269268 |
tctttatttcattgtcagtcctccccggcaattgcgccgcaatttgagaccatctgataagaagaaaatgaacataattttttaaaacggacggtattag |
38269367 |
T |
|
| Q |
107 |
tattgttagtattatacctagagtgagatcgaatcctcgacctccttatcactccattgcttaaccataggagatgatnnnnnnnnnggaactgagttag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38269368 |
tattgttagtattatacctagagtgagatcgaatcctcgacctccttatcactccattgcttaaccataggagatgataaaaaaaaaggaactgagttag |
38269467 |
T |
|
| Q |
207 |
tagttgaaatttacctattccccagaactgcatgaagtt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38269468 |
tagttgaaatttacctattccccagaactgcatgaagtt |
38269506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 45438357 - 45438303
Alignment:
| Q |
7 |
tctttatttcattgtcagtcctccccggcaattgcgccgcaatttgagaccatct |
61 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| || |||||||| |||||||| |
|
|
| T |
45438357 |
tctttatttcattatcagtcctccctggcaattgtgcagcaatttgtgaccatct |
45438303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University