View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16194_low_17 (Length: 221)
Name: NF16194_low_17
Description: NF16194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16194_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 44342190 - 44342387
Alignment:
| Q |
15 |
atgaagtgaatagtgagaaattgaataagta-gtactactcaccctacaacttggcggccacccatgttgttatatctctgcaactcccttccagagcga |
113 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44342190 |
atgaagtgaatagtgagaaattgaaaaagtaagtactactcacccaacaacttggcggccacccatgttgttatatctctgcaactcccttccagagcga |
44342289 |
T |
|
| Q |
114 |
gataccaaacaaaccatatctttatttcaactaacaaattgattgatga------atatatagaaaagagatcaagtgatgatatgttaactagagag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44342290 |
gataccaaacaaaccatatctttatttcaactaacaaattgattgatgaatatatatatatagaaaagagatcaagtgatgatatgttaactagagag |
44342387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University