View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16195_high_4 (Length: 370)
Name: NF16195_high_4
Description: NF16195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16195_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 10 - 357
Target Start/End: Original strand, 45370994 - 45371341
Alignment:
| Q |
10 |
aagaatatagagacttcatcatcaacaaatatcgtgaagaaccttctagaaggttaacattcaccgaggtacgaaaatcactcgtcggtgacgtcacttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45370994 |
aagaatatagagacttcatcatcaacaaatatcgtgaagaaccttctagaaggttaacattcaccgaggtacgaaaatcactcgtcggtgacgtcacttt |
45371093 |
T |
 |
| Q |
110 |
cttgaacaaggttttccttttcttggagtgttggggtttgattaactacggtgcgccttctgctggtaacgatggggaagcggagaaggaacatgaagag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45371094 |
cttgaacaaggttttccttttcttggagtgttggggtttgattaactacggtgcgccttctgctggtaacgatggggaagcggagaaggaacatgaaaag |
45371193 |
T |
 |
| Q |
210 |
gataggtgtaagttgaaggttgaggaaggtgctcctaatgggattcgtgttgttgctacaccgaattcgttgaagccgatttcattgccgcgggatacga |
309 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45371194 |
gagaggtgtaagttgaaggttgaggaaggtgctcctaatgggattcgtgttgttgctacaccgaattcgttgaagccgatttcattgccgcgggatacga |
45371293 |
T |
 |
| Q |
310 |
agattgctgctgctggtggtgatgagagtggggctggtgttaaaattg |
357 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45371294 |
agattgctgctggtggtggtgatgagagtggggctggtgttaaaattg |
45371341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University