View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16195_low_11 (Length: 211)
Name: NF16195_low_11
Description: NF16195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16195_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 17 - 116
Target Start/End: Complemental strand, 17564375 - 17564276
Alignment:
| Q |
17 |
agcaacaatccctcatttgttttaacttgttcaatcaaagtctcctcatgttgtttctgcattttcttttcaagttcttcatgcttcctaaaagtctatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17564375 |
agcaacaatccctcatttgttttaacttgttcaatcaaagtctcctcatgttgtttctgcattttcttttcaagttcttcatgcttcctaaaagtctatt |
17564276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 119 - 191
Target Start/End: Original strand, 17542033 - 17542105
Alignment:
| Q |
119 |
tgttgctcttgcatcttcttctctaaagcttctagctttctgatgagctcaacttgaatctcattatgcctat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17542033 |
tgttgctcttgcatcttcttctctaaagcttctagctttctgatgagctcaacttgaatctcattatgcctat |
17542105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 144 - 189
Target Start/End: Complemental strand, 24494255 - 24494210
Alignment:
| Q |
144 |
aagcttctagctttctgatgagctcaacttgaatctcattatgcct |
189 |
Q |
| |
|
|||||||| |||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
24494255 |
aagcttcttgctttctgataatctcagcttgaatctcattatgcct |
24494210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University