View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16195_low_5 (Length: 380)
Name: NF16195_low_5
Description: NF16195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16195_low_5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 18 - 380
Target Start/End: Original strand, 46184739 - 46185101
Alignment:
| Q |
18 |
cagcttgcaggtctcttaaccctactcgtcactggatccattttcctcctccttaccggtctaactgtcgccgccaccgtcgtctccctcatcttcttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184739 |
cagcttgcaggtctcttaaccctactcgtcactggatccattttcctcctccttaccggtctaactgtcgccgccaccgtcgtctccctcatcttcttct |
46184838 |
T |
 |
| Q |
118 |
ccccattgatcatcgtttcaagcccaatatgggtcccagctggtacctttctcttcctccttgcagctggattcttgtccatgtgtggatttggtgttgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184839 |
ccccattgatcatcgtttcaagcccaatatgggtcccagctggtacctttctcttcctccttgctgctggattcttgtccatgtgtggatttggtgttgt |
46184938 |
T |
 |
| Q |
218 |
tgctgtagctgcttcctcttggttctaccgttactttagaggtcttcatcctcccggttcggaccgggttgattatgcaaggaaccgcctttatgatact |
317 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184939 |
tgctgtagctgcttcctcttggttctatcgttactttagaggtcttcatcctcccggttcggaccgggttgattatgcaaggaaccgcctttatgatact |
46185038 |
T |
 |
| Q |
318 |
gcttctcatgttaaagattatgcaagagaatatggtggttatttgcagagtaaggttaaggat |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185039 |
gcttctcatgttaaagattatgcaagagaatatggtggttatttgcagagtaaggttaaggat |
46185101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University