View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16195_low_9 (Length: 310)
Name: NF16195_low_9
Description: NF16195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16195_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 47 - 291
Target Start/End: Original strand, 41172399 - 41172643
Alignment:
| Q |
47 |
gaagcgggtggtggagtcgacctggttttggaaaagcaggacattcttcttaagggtgaaggcaagtatggcggcgaaaaacaaacaaatggaggataat |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41172399 |
gaagcgggtggtggagtcgacctggttttggaaaagcaggacattcttcttaagggtgaaggcaagtatggcggcgaaaaacaaacaaatggaggataat |
41172498 |
T |
 |
| Q |
147 |
attgagaagatgacaatgggagagaaagcatgtgtgtttagaaaaagggtgaataggtaagtcgttggacccatggccataagcgtgcttatcttctgca |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41172499 |
attgagaagatgacaatgggagagaaagcatgtgtgtttagaagaagggtgaataggtaagtcgttggacccatggccataagcgtgcttatcttctgca |
41172598 |
T |
 |
| Q |
247 |
tcctgtctaaagcataaatgtagtcttctggtggatagttgagaa |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41172599 |
tcctgtctaaagcataaatgtagtcttctggtggatagttgagaa |
41172643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 50
Target Start/End: Original strand, 41172317 - 41172357
Alignment:
| Q |
10 |
agaagaagggaatgaaatgataattcgcaaagaagaagaag |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41172317 |
agaagaagggaatgaaatgataattcgcaaagaagaagaag |
41172357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University